ID: 984060283_984060288

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 984060283 984060288
Species Human (GRCh38) Human (GRCh38)
Location 4:174982016-174982038 4:174982055-174982077
Sequence CCAGTAGCAGGCCAAGAGCTGTC GTTATCTGCAGAAGATGGCAGGG
Strand - +
Off-target summary No data {0: 180, 1: 172, 2: 120, 3: 86, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!