ID: 984081411_984081420

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 984081411 984081420
Species Human (GRCh38) Human (GRCh38)
Location 4:175253463-175253485 4:175253493-175253515
Sequence CCAATGGAACCTTTCTTGCCCTG AATTAAGCACAGTGGGAACCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!