ID: 984093049_984093052

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 984093049 984093052
Species Human (GRCh38) Human (GRCh38)
Location 4:175398754-175398776 4:175398807-175398829
Sequence CCTTGAACAAAATAACAAAATCT ACTAAGTGTGATTAATCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 63, 4: 780} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!