ID: 984101030_984101033

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 984101030 984101033
Species Human (GRCh38) Human (GRCh38)
Location 4:175485841-175485863 4:175485868-175485890
Sequence CCATTAAGTGAATCAACATATTC AGTACTAAAAGCAAAGAAAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 43, 4: 295} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!