ID: 984127700_984127705

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 984127700 984127705
Species Human (GRCh38) Human (GRCh38)
Location 4:175832697-175832719 4:175832745-175832767
Sequence CCCCCAAACCATGCAAGATTTCT TTGATCTGTTATATTATTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 235} {0: 1, 1: 0, 2: 0, 3: 41, 4: 524}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!