ID: 984140872_984140876

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 984140872 984140876
Species Human (GRCh38) Human (GRCh38)
Location 4:176002340-176002362 4:176002353-176002375
Sequence CCCAGAGGAGAGCGAGTGACCAG GAGTGACCAGACGCTGCGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 139} {0: 1, 1: 0, 2: 0, 3: 6, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!