ID: 984167688_984167693

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 984167688 984167693
Species Human (GRCh38) Human (GRCh38)
Location 4:176321438-176321460 4:176321471-176321493
Sequence CCGTAGTAAACAGTAAATAGCAG TAGTATCCCCTTAATGGGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 232} {0: 1, 1: 0, 2: 0, 3: 7, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!