ID: 984181764_984181767

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 984181764 984181767
Species Human (GRCh38) Human (GRCh38)
Location 4:176491693-176491715 4:176491722-176491744
Sequence CCACATAAATTGATGTTCTCTCA CCAGGCTGCCTTTCAAAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 251} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!