ID: 984216378_984216383 |
View in Genome Browser |
Spacer: -1 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 984216378 | 984216383 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:176917304-176917326 | 4:176917326-176917348 |
| Sequence | CCTGTTTGGGGGTCAGCGGGTGA | AGGGGAAGAAACTTAGAGGACGG |
| Strand | - | + |
| Off-target summary | No data | {0: 3, 1: 28, 2: 199, 3: 281, 4: 621} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||