ID: 984219262_984219263

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 984219262 984219263
Species Human (GRCh38) Human (GRCh38)
Location 4:176953652-176953674 4:176953693-176953715
Sequence CCACTGTACTGATTAATTTAAAT ATTTCAATGTTCTAAATACAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 31, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!