ID: 984251735_984251738

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 984251735 984251738
Species Human (GRCh38) Human (GRCh38)
Location 4:177344163-177344185 4:177344191-177344213
Sequence CCGACCTGATTCTGTTTTCTACA AGTCAGCTTAAGACTTTGTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!