|
Left Crispr |
Right Crispr |
| Crispr ID |
984289778 |
984289780 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:177781070-177781092
|
4:177781123-177781145
|
| Sequence |
CCTAGTATTTGATAGCACAATAG |
AATAACTAAAAGAGTATAAGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 45, 1: 440, 2: 1034, 3: 1076, 4: 909} |
{0: 12, 1: 486, 2: 1010, 3: 1275, 4: 1448} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|