ID: 984291513_984291515

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 984291513 984291515
Species Human (GRCh38) Human (GRCh38)
Location 4:177801005-177801027 4:177801022-177801044
Sequence CCATCCTCTGGTAACTACTGCTC CTGCTCTACTCTCTACTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 136, 4: 800} {0: 1, 1: 0, 2: 8, 3: 43, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!