ID: 984340843_984340850

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 984340843 984340850
Species Human (GRCh38) Human (GRCh38)
Location 4:178454127-178454149 4:178454155-178454177
Sequence CCCAGGATGTCCATCTGGCTTCA CATTAGGACAGGAGGTTAGTTGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 409, 3: 304, 4: 242} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!