ID: 984418138_984418141

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 984418138 984418141
Species Human (GRCh38) Human (GRCh38)
Location 4:179486730-179486752 4:179486776-179486798
Sequence CCTTTTCAGGGGCTCAGTGTTTG ACTCAGTAGCAGCTTTAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 89, 4: 408} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!