ID: 984601831_984601832

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 984601831 984601832
Species Human (GRCh38) Human (GRCh38)
Location 4:181736678-181736700 4:181736704-181736726
Sequence CCTCAACTAGGTTATTTTTAAAT GAACAAATTAAAATTTGAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 205, 4: 2374} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!