ID: 984674317_984674322

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 984674317 984674322
Species Human (GRCh38) Human (GRCh38)
Location 4:182529524-182529546 4:182529570-182529592
Sequence CCATTTCATTCTTCTTCCTTTCT ACTCCACCCCATTTGGTTCAGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 57, 3: 585, 4: 4367} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!