ID: 984697010_984697016

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 984697010 984697016
Species Human (GRCh38) Human (GRCh38)
Location 4:182789262-182789284 4:182789305-182789327
Sequence CCACAGGTCAAATTGCCAGCATC GAAAGTAGATTATGACGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 148} {0: 1, 1: 0, 2: 0, 3: 10, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!