ID: 984697013_984697022

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 984697013 984697022
Species Human (GRCh38) Human (GRCh38)
Location 4:182789284-182789306 4:182789336-182789358
Sequence CCAGCGAGGCACCACTAGCGAGA GTGTCTCGGGTCTTTGCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 41} {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!