ID: 984712286_984712293

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 984712286 984712293
Species Human (GRCh38) Human (GRCh38)
Location 4:182895820-182895842 4:182895858-182895880
Sequence CCTGCAGAGTGTGATGGCCTGGG GAATTTGTAAGCAATTCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 252} {0: 1, 1: 0, 2: 0, 3: 12, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!