ID: 984734403_984734410

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 984734403 984734410
Species Human (GRCh38) Human (GRCh38)
Location 4:183097671-183097693 4:183097693-183097715
Sequence CCACCTTCGAGATTGGCCGCAGA ATGCCCCGACGGGATGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 18} {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!