ID: 984734924_984734931

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 984734924 984734931
Species Human (GRCh38) Human (GRCh38)
Location 4:183099612-183099634 4:183099625-183099647
Sequence CCCCGGGACAGGTGGGCGCCGGC GGGCGCCGGCCGCGGGGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 140} {0: 1, 1: 0, 2: 11, 3: 191, 4: 1350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!