ID: 984734933_984734945

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 984734933 984734945
Species Human (GRCh38) Human (GRCh38)
Location 4:183099630-183099652 4:183099674-183099696
Sequence CCGGCCGCGGGGGCGCGGGCCCG CCCGGAGACCCGGCCGCGCGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 35, 4: 516} {0: 1, 1: 0, 2: 2, 3: 15, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!