ID: 984734933_984734947

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 984734933 984734947
Species Human (GRCh38) Human (GRCh38)
Location 4:183099630-183099652 4:183099675-183099697
Sequence CCGGCCGCGGGGGCGCGGGCCCG CCGGAGACCCGGCCGCGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 35, 4: 516} {0: 1, 1: 1, 2: 2, 3: 9, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!