ID: 984750636_984750639

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 984750636 984750639
Species Human (GRCh38) Human (GRCh38)
Location 4:183269996-183270018 4:183270026-183270048
Sequence CCAGTGGGAAGCACAGAAACACA TGATGAACAAAGTTTAAGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 281} {0: 1, 1: 0, 2: 2, 3: 18, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!