ID: 984751978_984751986

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 984751978 984751986
Species Human (GRCh38) Human (GRCh38)
Location 4:183286851-183286873 4:183286876-183286898
Sequence CCCATCTGATTGAGAGTCAGAAG CTCAGTTGACAGCAGTTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 216} {0: 1, 1: 0, 2: 0, 3: 11, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!