ID: 984774289_984774294

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 984774289 984774294
Species Human (GRCh38) Human (GRCh38)
Location 4:183467215-183467237 4:183467238-183467260
Sequence CCTCATGGAGAACCTCGCTAGGG CAATGCAGAAGGGAAATGTGAGG
Strand - +
Off-target summary No data {0: 69, 1: 787, 2: 1175, 3: 1501, 4: 1624}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!