ID: 984778586_984778598

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 984778586 984778598
Species Human (GRCh38) Human (GRCh38)
Location 4:183504903-183504925 4:183504927-183504949
Sequence CCGGGACCCCGGCGCCGGCCCCG CGAGGGGATCCCCACTGCTCCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 16, 3: 213, 4: 878} {0: 1, 1: 0, 2: 1, 3: 6, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!