ID: 984820179_984820194

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 984820179 984820194
Species Human (GRCh38) Human (GRCh38)
Location 4:183875288-183875310 4:183875336-183875358
Sequence CCGCTTCCTCAAGGCTTTCATGG GGGTTTTAGAAGATGGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 329} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!