ID: 984827343_984827344

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 984827343 984827344
Species Human (GRCh38) Human (GRCh38)
Location 4:183938319-183938341 4:183938366-183938388
Sequence CCAGTTTGTGTTAGTAAATTAAC ACTTTAAAAAACTTTATTGATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 75, 4: 827}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!