ID: 984830238_984830248

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 984830238 984830248
Species Human (GRCh38) Human (GRCh38)
Location 4:183966132-183966154 4:183966178-183966200
Sequence CCAGGGAGGGAGTTTTGACCCCT GTTATGCCTGAGACGGTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 153} {0: 1, 1: 0, 2: 0, 3: 3, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!