ID: 984844408_984844416

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 984844408 984844416
Species Human (GRCh38) Human (GRCh38)
Location 4:184097804-184097826 4:184097820-184097842
Sequence CCCACACCTGAGTTAATGCTACT TGCTACTGAGAGGGGTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117} {0: 1, 1: 0, 2: 2, 3: 14, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!