ID: 984844688_984844692

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 984844688 984844692
Species Human (GRCh38) Human (GRCh38)
Location 4:184099464-184099486 4:184099482-184099504
Sequence CCTGACACACAATAGGTGTTCAA TTCAATAGGTGGCAACGGTCTGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 88, 3: 721, 4: 2610} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!