ID: 984847641_984847652 |
View in Genome Browser |
Spacer: 25 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 984847641 | 984847652 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:184121181-184121203 | 4:184121229-184121251 |
| Sequence | CCCTCCTCCTTTTCCCTATTCTA | ATTTCACAAGGATATGTCTGGGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 0, 2: 0, 3: 20, 4: 299} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||