ID: 984856617_984856624

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 984856617 984856624
Species Human (GRCh38) Human (GRCh38)
Location 4:184201008-184201030 4:184201041-184201063
Sequence CCCATGATCTGCCTTCTGGATCT CTGTCGAAAGGGCTGATGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 345} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!