ID: 984857059_984857065

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 984857059 984857065
Species Human (GRCh38) Human (GRCh38)
Location 4:184204455-184204477 4:184204488-184204510
Sequence CCTAGGCCTGAACCGTCCTCACA CTGGTTCTGAATCATGTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 156} {0: 1, 1: 0, 2: 3, 3: 10, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!