ID: 984886212_984886215 |
View in Genome Browser |
Spacer: -4 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 984886212 | 984886215 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:184452086-184452108 | 4:184452105-184452127 |
| Sequence | CCTTCACACCTCTATTTGGAGAC | AGACCCTCCTCAGGTGATGTAGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 1, 3: 10, 4: 129} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||