ID: 984893020_984893036

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 984893020 984893036
Species Human (GRCh38) Human (GRCh38)
Location 4:184510321-184510343 4:184510358-184510380
Sequence CCCTCAAATCCACCTCCCCAAGG GCTTTTAAGGGGATCATGAAGGG
Strand - +
Off-target summary {0: 1, 1: 12, 2: 21, 3: 68, 4: 295} {0: 1, 1: 6, 2: 34, 3: 51, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!