ID: 984893030_984893036 |
View in Genome Browser |
Spacer: -2 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 984893030 | 984893036 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:184510337-184510359 | 4:184510358-184510380 |
| Sequence | CCCAAGGAGTTCTTGGCTGGGGC | GCTTTTAAGGGGATCATGAAGGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 6, 2: 34, 3: 51, 4: 190} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||