ID: 984964570_984964582

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 984964570 984964582
Species Human (GRCh38) Human (GRCh38)
Location 4:185128707-185128729 4:185128727-185128749
Sequence CCCCGACGCACCCCGCGCATAGC AGCGACTGGTGGCCTGGTGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!