ID: 984966338_984966345

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 984966338 984966345
Species Human (GRCh38) Human (GRCh38)
Location 4:185143408-185143430 4:185143443-185143465
Sequence CCTGGCCGGGGGCGTCGCCGCTG CCGCGGTCGCCCCCATCGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 200} {0: 1, 1: 0, 2: 0, 3: 6, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!