|
Left Crispr |
Right Crispr |
| Crispr ID |
984970818 |
984970825 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:185188261-185188283
|
4:185188296-185188318
|
| Sequence |
CCCTCTAGCCTCAGCCTTCAAAG |
TAGGTATGTGCCACCACACCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 20, 3: 129, 4: 982} |
{0: 22, 1: 781, 2: 9339, 3: 38543, 4: 101260} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|