ID: 984973489_984973492

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 984973489 984973492
Species Human (GRCh38) Human (GRCh38)
Location 4:185210134-185210156 4:185210152-185210174
Sequence CCGCCTTCCTGCTGGGGATCCTG TCCTGTTTGCCCTCGTCTGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 57, 4: 463} {0: 1, 1: 0, 2: 2, 3: 3, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!