ID: 984988349_984988354

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 984988349 984988354
Species Human (GRCh38) Human (GRCh38)
Location 4:185352880-185352902 4:185352909-185352931
Sequence CCTATCATAACACCTGCCTGTGT CAGTCTCCCCAGAAGGCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 143} {0: 1, 1: 0, 2: 3, 3: 38, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!