ID: 984988351_984988354

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 984988351 984988354
Species Human (GRCh38) Human (GRCh38)
Location 4:185352896-185352918 4:185352909-185352931
Sequence CCTGTGTGTCTGTCAGTCTCCCC CAGTCTCCCCAGAAGGCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 422} {0: 1, 1: 0, 2: 3, 3: 38, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!