ID: 984989378_984989387

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 984989378 984989387
Species Human (GRCh38) Human (GRCh38)
Location 4:185364215-185364237 4:185364239-185364261
Sequence CCTTGGAGTATGGGCAGGGCCGA ATGGGGGAGCGGAAAGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 143} {0: 1, 1: 0, 2: 8, 3: 95, 4: 903}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!