ID: 985033398_985033406 |
View in Genome Browser |
Spacer: 19 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 985033398 | 985033406 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:185814645-185814667 | 4:185814687-185814709 |
| Sequence | CCCTATACCTCCAATTCCTGCTC | TCCCCCAGTTTGCACTGAACCGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 0, 3: 13, 4: 237} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||