ID: 985041208_985041213

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 985041208 985041213
Species Human (GRCh38) Human (GRCh38)
Location 4:185893531-185893553 4:185893583-185893605
Sequence CCCTCCAGCTTCTGAAGGTTTGA TAGACAGGTTAACAGCCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 255} {0: 1, 1: 0, 2: 2, 3: 17, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!