ID: 985064328_985064343

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 985064328 985064343
Species Human (GRCh38) Human (GRCh38)
Location 4:186105552-186105574 4:186105589-186105611
Sequence CCCCCGGGGCTGGCCCCAGAACC GCCTGACATCGGCGAGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 468} {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!