ID: 985073595_985073606

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 985073595 985073606
Species Human (GRCh38) Human (GRCh38)
Location 4:186191615-186191637 4:186191648-186191670
Sequence CCGGGCCGGGCGCAGGAACAGCC CTCTCTGGCCGCCGCCCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 188} {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!